Date Log
1. Copyright of the article is transferred to the journal, by the knowledge of the author, whilst the moral right of the publication belongs to the author.
2. The legal formal aspect of journal publication accessibility refers to Creative Commons Atribusi-Non Commercial-Share alike (CC BY-NC-SA), (https://creativecommons.org/licenses/by-nc-sa/4.0/)
3. The articles published in the journal are open access and can be used for non-commercial purposes. Other than the aims mentioned above, the editorial board is not responsible for copyright violation
The manuscript authentic and copyright statement submission can be downloaded ON THIS FORM.
Keragaman Gen Cytochrome B pada Sidat (Anguila bicolor) Berdasarkan Restriction Fragment Length Polymorphism (RFLP)
[Genetic Diversity Cythochrome B of Sidat (Anguila bicolor) Assesed by Restriction Fragment Length Polymorhisme (RFLP) ]
Corresponding Author(s) : Gunanti Mahasri
Jurnal Ilmiah Perikanan dan Kelautan, Vol. 6 No. 2 (2014): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Abstract
Abstract
This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %.
Keywords
Download Citation
Endnote/Zotero/Mendeley (RIS)BibTeX
- Aoyama, J., H. Sugeha, dan K. Tsukamoto. 2006. Downstream Migration of Tropical Anguillid Silver Eels. Prosiding Seminar Nasional Limnologi 2006 Avis, J.C. Lansman and R.O. Shade. 1979. The use Endonuclease to Mesure Mitochondria DNA Sequense Relatedness in Natural Populayions. I. Population Structure and Evolution in Genus Peromyscus. Genetic 92:279295
- Botstein., D.R., R.L White, M.Skolnick, and R.W. Davis. 1980. Construction of a Genetic Linkage Map in man Using Restriction Fragment Length Polymorphism, Am.J.Hum.Gen. 32:31314-331
- Brown, T. A. 1991. Pengantar Kloning Gen. Yogyakarta: Yayasan Essentia Medica
- Desjardin, P. and R. Moris. 1990. Sequence and gene organization of chicken mitochondria genom. A novel gene order in higjer vertebrate.J.Mol. Biol.212.599-624.
- Duryadi, 1994. Peran DNA Mitokondria (mt DNA) dalam studi keragaman genetic dan biologi populasi pada hewan. Hayati, Jurnal Biologi FMIPA IPB. 1(1):1-4
- Effendie, M.I. 1997. Biologi Perikanan, Yayasan Pustaka Nusatama, Yogyakarta, 163 p
- Hardys, H., M. Balick, and B. Schiewater, 1992. Application of Random Amplified Polymorphic DNA (RAPD) in Mol Ecol. 1: 56 – 63.
- Kocher T.D., Lee W.J., Sobolewska H., Penman D. & McAndrew B.1989. A Genetic Linkage Map Of A Cichlid Fish, The Tilapia (Oreochromis niloticus). Genetics 148.
- Maniatis, T. Sambrook, J. and Fritsch, E.F. 1989. Molecular Cloning (2th ed.). Harbor:Cold Spring Harbor Laboratory Press. New York.
- Moria, S.B. Haryanti. Permana, I. G. N and Sugama, K. 2001. Keragaman dan Kekerabatan Tiga Spesies Kerapu Epinephelus spp. Dengan Metode Restriction Fragment Length Polymorphism (RFLP) mtDNA. Teknologi Budidaya Laut dan Pengembangan Sea Farming di Indonesia. Jakarta:Departemen Kelautan dan Perikanan. Hal.285-292
- Nelson, J.S. 1994. Fishes of The World, 3rd editions. John Wiley and Sons, Inc., New York, 600pp
- Ovendem J (2000). Development and Restriction Enzyme Markers for Red Lutjanus malabaricus) Stock Descrimination Using Genetic Variation in Mitochondrial DNA. Molecular Fisheries Laboratory Southern Fisheries Centre. Produced for CSIRO Marine Laboratories as Part of The ACIAR Indonesia Snapper Project
- Perez-Enriquez, R., Takagi, M. and Taniguchi, N. (2007). Genetic Variability And Pedigree Tracing Of A HatcheryReared Stock Of Redsea Bream (Pagrus Major) Used For Stock Enhancement, Based On Microsatellite DNA markers. Aquaculture 173, 413– 423.
- Primack, R. B. Supriatna, J. Indrawan, M. & Kramandibrata,P. 1998. Essentials of Conservation Biology. Sinauer Asssociate, Sunderland, Massachusetts. Saputra, D. 2009. Gambaran (RFLP) Gen Sitokrom b DNA Mitokondria dari Sembilan Spesies Ikan Air Tawar. Skripsi Fakultas Kedokteran Hewan, Institut Pertanian Bogor.
- Setiawan I.E, Rovara, O dan M.H Amarullah. 2007. Mengenal Sumberdaya Ikan Sidat. BPPT-HSF, Jakarta. Program Pasca Sarjana Institut Pertanian Bogor.
- Sartika, Tike, 2000. Studi Keragaman Fenotip dan Genetik Ayam Kampung pada populasi dasar seleksi. Thesis. Program Pasca Sarjana Institut Pertanian Bogor. Bogor
- Teng, H.Y, Y.S. Lin, dan T.S. Tzeng. 2009. A New Anguilla Species and a Reanalysis of the Phylogeny of Freshwater Eels. Department of Life Science, National Tsing Hua University, Hsinchu 300, Taiwan. J. 48(6): 808-822
- Tesch, F.W. 1977. The eel biology and management of anguila eels. Chapman and Hall. London 434 p. Snapper (Lutjanus erythropterus and genus anguila. University of Tokyo. J. coastal marine Sci. 32 (3)
- Watanabe, S, J. Aoyama, K. Tsukamoto. 2008. The Use of Morphological and molecular genetic variation in the genus anguila. University of Tokyo. J. coastal marine Sci. 32 (3)
- Warwick, E.J., H.J.Astuti,M.J. and W. Hardjo Subroto, 1987. Pemuliaan. Ternak. Gajah Mada University Press. Jogjakarta
References
Aoyama, J., H. Sugeha, dan K. Tsukamoto. 2006. Downstream Migration of Tropical Anguillid Silver Eels. Prosiding Seminar Nasional Limnologi 2006 Avis, J.C. Lansman and R.O. Shade. 1979. The use Endonuclease to Mesure Mitochondria DNA Sequense Relatedness in Natural Populayions. I. Population Structure and Evolution in Genus Peromyscus. Genetic 92:279295
Botstein., D.R., R.L White, M.Skolnick, and R.W. Davis. 1980. Construction of a Genetic Linkage Map in man Using Restriction Fragment Length Polymorphism, Am.J.Hum.Gen. 32:31314-331
Brown, T. A. 1991. Pengantar Kloning Gen. Yogyakarta: Yayasan Essentia Medica
Desjardin, P. and R. Moris. 1990. Sequence and gene organization of chicken mitochondria genom. A novel gene order in higjer vertebrate.J.Mol. Biol.212.599-624.
Duryadi, 1994. Peran DNA Mitokondria (mt DNA) dalam studi keragaman genetic dan biologi populasi pada hewan. Hayati, Jurnal Biologi FMIPA IPB. 1(1):1-4
Effendie, M.I. 1997. Biologi Perikanan, Yayasan Pustaka Nusatama, Yogyakarta, 163 p
Hardys, H., M. Balick, and B. Schiewater, 1992. Application of Random Amplified Polymorphic DNA (RAPD) in Mol Ecol. 1: 56 – 63.
Kocher T.D., Lee W.J., Sobolewska H., Penman D. & McAndrew B.1989. A Genetic Linkage Map Of A Cichlid Fish, The Tilapia (Oreochromis niloticus). Genetics 148.
Maniatis, T. Sambrook, J. and Fritsch, E.F. 1989. Molecular Cloning (2th ed.). Harbor:Cold Spring Harbor Laboratory Press. New York.
Moria, S.B. Haryanti. Permana, I. G. N and Sugama, K. 2001. Keragaman dan Kekerabatan Tiga Spesies Kerapu Epinephelus spp. Dengan Metode Restriction Fragment Length Polymorphism (RFLP) mtDNA. Teknologi Budidaya Laut dan Pengembangan Sea Farming di Indonesia. Jakarta:Departemen Kelautan dan Perikanan. Hal.285-292
Nelson, J.S. 1994. Fishes of The World, 3rd editions. John Wiley and Sons, Inc., New York, 600pp
Ovendem J (2000). Development and Restriction Enzyme Markers for Red Lutjanus malabaricus) Stock Descrimination Using Genetic Variation in Mitochondrial DNA. Molecular Fisheries Laboratory Southern Fisheries Centre. Produced for CSIRO Marine Laboratories as Part of The ACIAR Indonesia Snapper Project
Perez-Enriquez, R., Takagi, M. and Taniguchi, N. (2007). Genetic Variability And Pedigree Tracing Of A HatcheryReared Stock Of Redsea Bream (Pagrus Major) Used For Stock Enhancement, Based On Microsatellite DNA markers. Aquaculture 173, 413– 423.
Primack, R. B. Supriatna, J. Indrawan, M. & Kramandibrata,P. 1998. Essentials of Conservation Biology. Sinauer Asssociate, Sunderland, Massachusetts. Saputra, D. 2009. Gambaran (RFLP) Gen Sitokrom b DNA Mitokondria dari Sembilan Spesies Ikan Air Tawar. Skripsi Fakultas Kedokteran Hewan, Institut Pertanian Bogor.
Setiawan I.E, Rovara, O dan M.H Amarullah. 2007. Mengenal Sumberdaya Ikan Sidat. BPPT-HSF, Jakarta. Program Pasca Sarjana Institut Pertanian Bogor.
Sartika, Tike, 2000. Studi Keragaman Fenotip dan Genetik Ayam Kampung pada populasi dasar seleksi. Thesis. Program Pasca Sarjana Institut Pertanian Bogor. Bogor
Teng, H.Y, Y.S. Lin, dan T.S. Tzeng. 2009. A New Anguilla Species and a Reanalysis of the Phylogeny of Freshwater Eels. Department of Life Science, National Tsing Hua University, Hsinchu 300, Taiwan. J. 48(6): 808-822
Tesch, F.W. 1977. The eel biology and management of anguila eels. Chapman and Hall. London 434 p. Snapper (Lutjanus erythropterus and genus anguila. University of Tokyo. J. coastal marine Sci. 32 (3)
Watanabe, S, J. Aoyama, K. Tsukamoto. 2008. The Use of Morphological and molecular genetic variation in the genus anguila. University of Tokyo. J. coastal marine Sci. 32 (3)
Warwick, E.J., H.J.Astuti,M.J. and W. Hardjo Subroto, 1987. Pemuliaan. Ternak. Gajah Mada University Press. Jogjakarta
